Site Loader
Rock Street, San Francisco

Malaysia HIV-1 epidemic shows the enormous increase in HIV instances since its first notified instances in 1986. 26 old ages after the eruption, as of December 2011 the Ministry of Health estimated at 81,000 people are populating with HIV-1 in Malaysia ; the epidemic is concentrated within the most-at-risk populations particularly among Injecting Drug Users ( IDU ) , Sex workers, transgender, and work forces who have sex with work forces ( MSM ) . In the early twelvemonth of Malaysia epidemic, about 90 % of infection persons were aggravated among male and IDU ‘s population with the ratio of 1:99 in 1990. However the forms were dramatically spread among female population into about 1 female for every 4 male whom populating with HIV.

The outgrowth of assorted HIV-1 circulating recombinant signifiers ( CRF ) and other subtypes, exhibit the singular familial diverseness determined by their rapid mutant ( Malim MH et Al 2001 ) , recombination factors and their antiretroviral oppositions on most of conventional drug therapy. The discovery of HIV-1 diverseness at times, turn out the ongoing transmittal, and claim the viral sovereignty within human population. Since so, planetary population had faced terrible downswing due to the failure of existed drug to get the better of the viral infection. In 1997, the debut of peptidase inhibitors cocktails with other antiretroviral which subsequently named as Highly Active Anti-retroviral therapy ( HAART ) , supplying a new hope for people-Living with HIV ( PLHIV ) by puting the HIV into chronic but treatable status. ( www.unicef.org/unaids ) .

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

The recombination well contributes to the overall familial diverseness of HIV-1 and multiple genotypes quickly co-circulated, ease the diverse coevals of HIV-1 signifiers Wang W. et Al ( 2011 ) . The purpose of this survey is to test for possible new go arounding recombinants signifiers ( CRF ) among HIV-1 seropositive persons of Kajang Prison, and to govern out the molecular epidemiology forms of HIV-1 among captive in Malaysia.

MATERIAL AND METHOD:

Study topics and specimens

All topics ( n=8 ) were HIV-1 seropositive captives of HARAPAN from Kajang Prison, Malaysia in August 2010. All survey participants were all male and their samples were named with the alone designation Numberss harmonizing to HARAPAN sample aggregation datasheet. Such samples were PR162, PR216, PR217, PR219, PR220, PR226, PR229, and PR230. Since the samples collected from prison, inside informations refering participants demographic background and clinical information were unable to be retrieved as per discussed by Li et Al ( 2010 ) . This survey was approved by University Malaya Medical Centre ( UMMC ) Medical Ethics Committee. The specimens from 8 patients were serologically determined as HIV-1 positive and there were no HIV-2 infections detected. HIV-1 genotypes were screened based on Protease and Reverse Transcriptase part utilizing frozen plasma HIV-1 RNA as described by Tee et Al ( 2005 ) .

HIV-1 genotypic finding, isolation of viral part, and bases sequencing.

HIV-1 RNA was extracted from frozen plasma utilizing magnetic beads and Nuclisens biomerieux ( USA ) automated extraction device. The RNA was rearward transcript into complementary DNA ( complementary DNA ) by contrary written text Polymerase Chain reaction ( RT PCR ) utilizing random hexamer ( GeneAmp®RNA PCR, USA ) primer and synthesized by Superscript III enzyme ( Invitrogen, Carlsbad, CA ) . The HIV-1 complementary DNA were subjected to a nested PCR on the footing of Pol ( Protease-RT ) part harmonizing to HXB2 mention Strain ( bases ) . The nested PCR was performed harmonizing to QIAGEN hOTsTARTtAQ® Plus DNA Polymerase ( QIAGEN HotStartTaq kit, QIAGEN, Germany ) with initial denaturation temperature at 95 & A ; deg ; C for 5 proceedingss, and 35 rhythms of denaturation at 94 & A ; deg ; C for 30 seconds, tempering at 50 & A ; deg ; C for 1 proceedingss, elongation at 72 & A ; deg ; C for 1 proceedingss and 45 seconds, and concluding elongation at 72 & A ; deg ; C for 10 proceedingss. 2 µL of complementary DNA was aliquoted for the first PCR and 5µL of first PCR merchandise was aliquoted for subsequent nested PCR. For pol part, primers ( P24A: AAG GAA CCC TTT AGA GAC TAT GTA GA, HXB2:1657 & A ; agrave ; 1682 ) ( P24B: TATGGATTTTCAGGCAATTTTTG, HXB2: 2692 & A ; szlig ; 2716 ) and nested with primers ( P24C: GTAAAAAATTGGATACAGAAACCTTG, HXB2: 1726 & A ; agrave ; 1752 ) ( P24D: ACTTTTGGGCATCCATTCC, HXB2: 2592 & A ; szlig ; 2611 ) were used for protease part while primers ( K1: GGAAACCAAAAATGATAGGGGGAATTGGAGG, HXB2:2377 & A ; agrave ; 2407 ) ( K2: CTG TAC TTC TGC TAC TAA GTC TTT TGATGGG, HXB2: 3509 & A ; szlig ; 3539 ) and nested with primers ( K3: GTGGAAAAAAGGCTATAGGTACAG, HXB2: 2452 & A ; agrave ; 2475 ) ( K4: CTG CCA ACT CTA ATTCTGCTTC, HXB2: 3441 & A ; agrave ; 3462 ) were used for RT part in nested PCR modified cycling status based on Tee et Al ( 2006 ) . The amplicons of targeted part were detected utilizing 1.2 % agarose gel cataphoresis base on GeneRuler DNA ladder 1kb ( Fermentas, GeneRulerTM, ThermoFisher Scientific.Inc ) .

Phylogenetic Analysis

The Nucleotides sequences of partial HIV-1 genomes ( HXB2 gag-pol part: 1753 & A ; agrave ; 3439 ) were aligned with the HIV-1 mentions subtypes and CRF ‘s obtained from Los Alamos HIV Database ( hypertext transfer protocol: //hiv-web.lanl.gov/ ) , utilizing the ClustalX 2.0.11. The sequences were farther adjusted manually based on codon place of HIV sequence Collection 2011. Phylogenetic trees were constructed utilizing neighbour-joining method Saitou N et Al ( 1987 ) based on KIMURA-2 parametric quantity theoretical account with passage -to-transversion ratio of 2.0, brace wise omission and 1000 bootstrap reproductions for statistical support. The analysis was executed in Molecular Evolutionary Genetic Analysis ( MEGA ) version 5.0 package platform.

Consequence:

samples

RT part

PR part

PR162

Positive

PR216

PR217

Positive

Positive

PR219

Positive

Positive

PR220

Positive

Positive

PR226

Positive

Positive

PR229

PR230

Positive

Positive

Table 1

Recombinant designation plan ( R.I.P )

Patient PR162 -pro part

FIGURE 1: S distance ( similarity )

Figure 1 show the S distance similarity of question ( PR 162 ) peptidase part in comparing with other HIV-1 subtypes and CRF ‘s for the designation of recombinants. The length of the Query is about 833bp and BLAST shows sample PR162 peptidase part is similar to insulate 05MYKL031, complete sequence of Malaysia from the HIV database.

PR217 -PR part:

Figure 2: S distance ( similarity )

Figure 2 show the S distance similarity of question ( PR 217 ) peptidase part in comparing with other HIV-1 subtypes and CRF ‘s for the designation of recombinants. The length of the Query is about 848bp and BLAST shows sample PR217 peptidase part is similar to insulate 07CNHB_ES52 of gag-pol protein of China from the HIV database.

Sample PR219 -PRRT part

Figure 3: S distance ( similarity )

Figure 3 show the S distance similarity of question ( PR 219 ) pro-RT part in comparing with other HIV-1 subtypes and CRF ‘s for the designation of recombinants. The length of the Query is about 1681bp and BLAST shows sample PR219 pro-RT part is similar to insulate 04MYKL005, complete genome of Malaya from the HIV database.

PR220 – PRRT part

Figure 4: S distance ( similarity )

Figure 4 show the S distance similarity of question ( PR 220 ) pro-RT part in comparing with other HIV-1 subtypes and CRF ‘s for the designation of recombinants. The length of the Query is about 1682bp and BLAST shows sample PR220 pro-RT part is similar to insulate 96CNKM006, gag-pol merger poly-protein of China from the HIV database.

PR226 -PRRT part

Figure 5: S distance ( similarity )

Figure 5 show the S distance similarity of question ( PR 226 ) pro-RT part in comparing with other HIV-1 subtypes and CRF ‘s for the designation of recombinants. The length of the Query is about 1673bp and BLAST shows sample PR226 peptidase part is similar to insulate 04MYKL014, gag-pol protein of Malaya from the HIV database.

PR230-PRRT part

Figure 6: S distance ( similarity )

Figure 6 show the S distance similarity of question ( PR 230 ) pro-RT part in comparing with other HIV-1 subtypes and CRF ‘s for the designation of recombinants. The length of the Query is about 1676bp and BLAST shows sample PR230 peptidase part is similar to insulate 07IDJKT194-C, proviral DNA about complete genome of Jakarta from the HIV database.

Discussion:

Eight samples ( PR162, PR216, PR217, PR219, PR220, PR226, PR22, PR226 ) of frozen plasma from single antecedently HIV-1 seropositive tested from Kajang Prison Malaysia, two ( PR216 AND PR 229 ) of them were re-identified as HIV-1 sero-negative ( as referred to postpone 1 ) . The PR 216 was referred as patient who had been under-gone unknown antiretroviral therapy which antecedently the frozen plasma from the same person ( PR164 ) was tested for the HIV-1 genotype with negative consequence. Sample PR 229 was identified as false positive HIV-1 rapid agglutination trial and re-confirm as HIV-1 negative single therefore being excluded from the research.

Samples PR219, 220, 230 were amplified based on the nested PCR modified cycling protocol by Tee et Al ( 2006 ) . While PR162 Pro parts, PR217 Pro part, PR226 were amplified after extra of Qiagen Q-solution. The PR217 RT-region was amplified without Q-solution but increase PCR cycling from 35 rhythms to 40 rhythms. All the positive amplified samples were subjected PCR purification utilizing Qiagen Spin-column technique while sample PR220 RT-region was subjected to Gel purification due to multiple sets amplified and samples were send for sequencing.

The subtypes B among shooting drug users ( IDU ) and CRF01_AE among heterosexually most at hazard group were the two chief strains originating HIV/AIDS in Southeast Asia part in early twelvemonth ( Liu Y. et Al 2012 ) . The co-circulation of such strains has given rise to assorted new CRF descended from B subtypes and CRF01_AE. Harmonizing to Los Alamos HIV database ( www.hiv.lanl.gov ) So far, there are 8 CRF ‘s emerged from the Chimera of two major go arounding subtypes in Southeast Asia such CRF15_01B ( Tovanabutra S. et Al 2001 ) , CRF33_01B ( tee et al 2006 ) , CRF34_01B ( Tovanabutra S. et Al 2007 ) , CRF48_01B ( Li Y et Al 2010 ) , CRF51_01B ( Ng et al 2012 ) , CRF52_01B ( Liu Y et Al 2012 ) , CRF53_01B ( Chow et al 2012 ) , and CRF54_01B ( Ng et al 2012 ) .

In this survey, most of the screened Protease and RT parts were identified to be closely related to CRF33_01B ( PR162 pro part, PR219 PRRT part, PR260 PRRT part, PR230 PRRT part ) which had been discuss antecedently by Tee et Al ( 2006 ) while sequences sub-region PR217 Pro part and PR220 PRRT part have been identified to be similar with subtypes B. This happening proves that CRF33_01B is so the common CRF ‘s circulating among HIV positive person in in Malaysia. Interestingly, PR162 pro part appear to constellate along with CRF53_01B ( sequence 10MYKJ079_53 ) which late discussed by Chow et Al 2012 and sequence PR217 pro part shows short length of subtype D about 100 base-pairs ( figure 2 ) which might be suspected as possible URF. However, analysis on full length genome is required for farther treatment.

Sample troubleshot:

Since the innovation of polymerase concatenation reaction ( PCR ) by K.Mullis and colleagues in 1983, the technique permit the development in scientific survey by presenting the rapid generation of a individual DNA/RNA fragments into 1000000s of transcripts. It has been a cardinal tool for multidisciplinary facet of evident based research including sensing of Human Immunodeficiency Virus ( HIV ) in human cells. It led to intense activity in the field of molecular virology which continues relevant until present twenty-four hours. PCR aid to magnify three structural cistrons and six other regulative cistrons encoded of HIV construction and aid to better understand the replicative form of HIV and its ‘ noncompliant mechanism towards antiretroviral therapy ( ART ) . It is besides indispensable in specifying the heterogeneousness of HIV diverse population throughout the planetary ( smith et al 1988 ) .

There are ever-increasing demands for farther betterments of PCR protocols for cost-efficient and high-throughput efficaciousness of peculiar analysis at genome or everyday diagnostic intents ( Csako G et Al 2006, Dinging C. et al 2004 ) . One of the major confounding factors restricting the PCR merchandise is that a figure of DNA/RNA sequences are ill or non amplifiable under standard reaction conditions, either because of their intrinsic belongingss to organize secondary constructions, and/or because of their high GC content ( Ralser M. et Al 2006 ) . Assorted samples required assorted alteration in the PCR protocol including stepwise decrease tempering temperature for each rhythm ( Nagai M. et Al, 1998 ) , or alteration in DNA polymerase prior ‘HotStart ‘ reaction ( Kellog D.E et Al 1994 ) . Apart from substance enhanced/yield PCR specificity, PCR heightening additives are necessary such Betaine ( Henke W. et Al 1997 ) , dimethyl sulfoxide ( DMSO ) ( Chakrabarthu R. et Al, 2001 ) and Dithiothreitol ( DTT ) ( Nagai M. et Al 1998 ) . Commercial foils have led to better consequence but overpriced and unknown chemical composing.

Post Author: admin

x

Hi!
I'm Percy!

Would you like to get a custom essay? How about receiving a customized one?

Check it out